A fab book from a great brain and good friend of Brian May – making quantum physics and sciences wonderfullly accessible to ‘the man in the street’. …
“Marcus Chown rocks!” BRIAN MAY, QUEEN
—
“WHAT A WONDERFUL WORLD”
One Man’s Attempt to Explain the Big Stuff
by MARCUS CHOWN
Author of We Need To Talk About Kelvin (shortlisted for 2010 Royal Society Book Prize)
Publishing date: 3 October,
£17.99 hardback – link to AMAZON
£12.99 ebook edition
Why do we breathe? What is money? How does the brain work? Why in the world did life invent sex when asexual reproduction is so much less bother? How does capitalism work – or not, as the case may be? Why, when we share 99 % of our DNA with chimpanzees, does the 1% make such a huge difference? How can something invisible that comes down a wire power our civilisation? How do computers work, and what will computers never be able to do? How did an advanced breed of monkey like us get to dominate the Earth? Why is there something rather than nothing?
In What a Wonderful World, Marcus Chown, bestselling author of Quantum Theory Cannot Hurt You and the Solar System for iPad app, widens his usual scope to explain not only how the scientific world works but how the whole world works. In this lucid, witty and hugely entertaining book, he stops along the way to show us why the Atlantic is widening by a thumbs’ length each year, why you age more slowly on the ground floor of a building than the top floor, how money permits trade to time travel, why the crucial advantage humans had over Neanderthals was sewing and why we all could be living in a giant hologram. Read this book – and wonder…
PRAISE FOR MARCUS CHOWN:
‘Finest cosmology writer of our day’ Matt Ridley
‘The award for the cleverest title of the year goes to the popular science writer Marcus Chown for We Need to Talk About Kelvin – the content also doesn’t disappoint.’ Independent on Sunday
‘A limousine among popular-science vehicles’ Independent (on The Never-Ending Days of Being Dead)
‘Weird, sexy and mind-blowing.” Nature (on Quantum Theory Cannot Hurt You)
“Marcus Chown rocks!” BRIAN MAY, QUEEN
Marcus Chown is an award-winning writer and broadcaster. Formerly a radio astronomer at the California Institute of Technology in Pasadena, he is currently cosmology consultant of the weekly science magazine New Scientist. He is the author of the bestselling Quantum Theory Cannot Hurt You, The Never Ending Days of Being Dead and The Magic Furnace. He also wrote The Solar System, the bestselling app for iPad, which won
The Bookseller Digital Innovation of the Year Award 2011. www.marcuschown.com @marcuschown
What A Wonderful World – On Tour!
23rd Oct Foyles, Charing Cross Road
16th Nov 2 pm Folkestone Festival
22nd Nov Harrogate event
14th May 2014 Dorking Library
Bristol Waterstones (Date TBC) ‘
… And I think to myself… what a wonderful world’
You are 1/3 mushroom
We’re related to fungi – sharing 1/3 of our DNA with them (As if my Christmas card list wasn’t long enough…)
You could fit the entire human race in the volume of a sugar cube
That’s because atoms are 99.9999999999999% empty space. So, if you squeezed out all the empty space from all the atoms in all the people in the world you could indeed fit the human race in the volume of a sugar cube
Slime moulds have 13 sexes
Each can mate with all other sexes (& you think it’s hard finding & keeping a partner!)
You age more slowly on the ground floor of a building
It’s a consequence of Einstein’s theory of gravity, which says that time flows more slowly in strong gravity (If you want to live long and prosper, move to a bungalow)
Today your body will build about 300 billion cells
That’s more than there are stars in our Milky Way galaxy (No wonder I feel knackered doing nothing)
Every one of us spent half an hour as a single cell
I remember it being very boring. I couldn’t wait for some friends to play with
Each of us is a galaxy. In fact, 1000 galaxies
There are more cells in a human body than stars in 1000 galaxies
Almost all your cells get replaced every 7 years
Does it explain 7-year itch? You look at partner & think ‘That’s not the person I met’
You are 99.75% alien!
Only 0.25% of the genes operating in your body belong to your cells. The rest are in microorganisms hitching a ride. You are born 100% you. You die 99.75% alien (In fact, you are born 100% human but die 99.75% alien)
About 29 per cent of people have MRSA, or Staphylococcus aureus, in their nasal passages They suffer no ill effects. Babies are powered by rocket-fuel
That’s right, the very same mixture of hydrogen and oxygen that boost the Space Shuttle into space is the source of all our energy
The Earth does not have an energy crisis
All the energy absorbed from the Sun is re-radiated into space. If this was not the case, the Earth would just get hotter and hotter until it was molten. What the Earth actually has is an entropy crisis
The DNA sequence in every living thing on Earth (including you): GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCA GTTAAAAAG
In 2012, a US team encoded a book in DNA They made 70 billion copies, all of which fitted in a drop of water
Everyone on Earth – even the most macho of males – was in touch with their feminine side for the first 40 days of their existence
Humans are one of only three species known to experience a menopause The others are killer whales and short-finned pilot whales
The juvenile sea squirt wanders through the sea looking for a rock to cling to. On finding one, it no longer needs its brain. So it… eats it
For 1.4 million years – 60,000 generations – there was no improvement in the design of stone hand axes Palaeoanthropologists call this the ‘1.4 million years of boredom’
The crucial advantage that humans had over Neanderthals was… sewing No one has ever found a Neanderthal needle. It is thought that the sewing of baby clothes gave human babies a crucial 1% survival advantage in the ice age winters and this may explain why humans outcompeted Neanderthals
2.5 per cent of DNA of modern humans living outside of Africa is believed to be Neanderthal
The bodies and brains of Cro-Magnons, our ancestors in Europe, were between 5 and 10 per cent bigger than ours
The electric force is 10,000 billion billion billion billion times stronger than gravity
This is the secret of electricity and why it can power our world
The electrical energy in a single mosquito is enough to cause a global mass extinction
IBM once predicted that the global market for computers was… 5
To understand a Collaterised Debt Obligation Squared – one of the toxic investments that sunk the world economy in 2008 – you would need to read 1 billion pages of documentation
Money enables trade to time travel (and space travel)
The Atlantic is widening by about 5 centimetres a year
Britain and the United States are in the midst of a long goodbye.
J. J. Thomson got the Nobel Prize for proving the electrons is a particle. His son, George Thomson got the Nobel Prize for proving it isn’t
I bet that was fun for the rest of the Thompson family at get-togethers. “It is.” “It isn’t!” “It is!”
1 per cent of the static, or “snow”, on your TV screen is the leftover heat from the big bang
We may be living in a giant hologram
-oOo-
If everything in our information-overloaded society has passed you by in a high-speed blur, this book will bring you quickly and painlessly up to speed on how the world of the 21st century works. Open its pages and discover what a truly wonderful world we live in.
Marcus is available for publicity. For more information please contact Ruth Killick on 07880703741 / publicity@ruthkillick.co.uk